[ Program Manual | User's Guide | Data Files | Databases ]
Map maps a DNA sequence and displays both strands of the mapped sequence with restriction enzyme cut points above the sequence and protein translations below. Map can also create a peptide map of an amino acid sequence.
Map displays a sequence that is being assembled or analyzed intensively. Map asks you to select the enzymes whose restriction sites should be marked individually by typing their names. If you do not answer this question, Map selects a representative isoschizomer from all of the commercially available enzymes. You can choose to have your sequence translated in any or all of the six possible translation frames. You can also choose to have only the open reading frames translated.
After running Map, you may create a new sequence file with the peptide sequence from any frame of DNA translation by using the ExtractPeptide program with the Map output file.
Here is a session using Map to display a portion of gamma.seq, along with a restriction map and six-frame protein translation:
% map
(Linear) MAP of what sequence ? gamma.seq
Begin (* 1 *) ? 2161
End (* 11375 *) ? 2600
Select the enzymes: Type nothing or "*" to get all enzymes. Type "?"
for help on which enzymes are available and how to select them.
Enzyme(* * *):
What protein translations do you want:
a) frame 1 b) frame 2 c) frame 3
d) frame 4 e) frame 5 f) frame 6
t)hree forward frames s)ix frames o)pen frames only
n)o protein translation q)uit
Please select (capitalize for 3-letter) (* t *): s
What should I call the output file (* gamma.map *) ?
Mapping .........................
Writing ........ ..
MAP complete with:
Sequence Length: 440
Enzymes Chosen: 216
Cutsites found: 116
CPU time: 00.91
Output file(s): gamma.map
%
(Linear) MAP of: gamma.seq check: 6474 from: 2161 to: 2600
Human fetal beta globins G and A gamma
from Shen, Slightom and Smithies, Cell 26; 191-203.
Analyzed by Smithies et al. Cell 26; 345-353.
With 216 enzymes: *
September 24, 1996 16:19 ..
HgaI
SimI
NlaIII|
BsaJI ||
DsaI ||
NcoI ||
StyI ||
BsaHI | || RleAI
BspGI | | || MnlI BseRI |
BfaI | | | || MnlI | CviJI | | CviJI
| | | | || | | | | | |
GCTCCTAGTCCAGACGCCATGGGTCATTTCACAGAGGAGGACAAGGCTACTATCACAAGC
2161 ---------+---------+---------+---------+---------+---------+ 2220
CGAGGATCAGGTCTGCGGTACCCAGTAAAGTGTCTCCTCCTGTTCCGATGATAGTGTTCG
a A P S P D A M G H F T E E D K A T I T S -
b L L V Q T P W V I S Q R R T R L L S Q A -
c S * S R R H G S F H R G G Q G Y Y H K P -
2161 ---------+---------+---------+---------+---------+---------+ 2220
d G L G S A M P * K V S S S L A V I V L -
e E * D L R W P D N * L P P C P * * * L -
f S R T W V G H T M E C L L V L S S D C A -
///////////////////////////////////////////////////////////////////////
Enzymes that do cut:
AccI AluI AvaII BanI BbvI BccI Bce83I BfaI
BglI BmgI BpmI BsaHI BsaJI BseRI BsgI BslI
Bsp1286I BspGI BstEII CjePI CviJI CviRI DdeI DpnI
///////////////////////////////////////////////////////////////////////
Enzymes that do not cut:
AatII AceIII AciI AflII AflIII AhdI AlwI Alw26I
AlwNI ApaI ApaBI ApaLI ApoI AscI AvaI AvrII
BaeI BamHI BanII BbsI BcefI BcgI BciVI BclI
///////////////////////////////////////////////////////////////////////
Map accepts a single nucleotide or protein sequence as input. The function of Map depends on whether your input sequence(s) are protein or nucleotide. Programs determine the type of a sequence by the presence of either Type: N or Type: P on the last line of the text heading just above the sequence. If your sequence(s) are not the correct type, turn to Appendix VI for information on how to change or set the type of a sequence.
MapSort, PlasmidMap, and MapPlot display restriction maps in other formats. ExtractPeptide extracts the peptide sequence from any translation frame in the Map output file and puts it into a new sequence file. FindPatterns searches for short patterns like enzyme recognition sites in one or more sequences. PeptideMap creates a peptide map of an amino acid sequence. You can use either Map or PeptideMap with protein sequence input and obtain identical results.
Map does not treat your sequence as circular unless you use the command-line parameter -CIRcular.
The enzymes you name must be in the enzyme data file or you get an error message. You can have your system manager change the public enzyme data file to contain the enzymes most useful to your group, or you can maintain a private copy for your own use. (See the LOCAL DATA FILES topic below for more information.)
This program normally requires that a sequence pattern be a subset of the enzyme recognition site. If the recognition pattern in the enzyme data file were GCRGC, then the pattern GCAGC in your sequence would be found, since A is within the set of bases defined by R (see Appendix III). If the pattern in the enzyme data file were GCAGC, then a GCRGC in your sequence would not be recognized. If your sequence is very ambiguous, as it might be if it were a backtranslated sequence, then it may be better to use the -ALL parameter to do an overlap search. The overlap search would consider an R in your sequence to match an A in the recognition site.
The command-line parameter -PERFect causes this program to look for a perfect symbol match between your sequence and the recognition pattern -- GCRGC in the recognition pattern would only match a GCRGC in the sequence.
All searches are case insensitive (upper- or lowercase) for the letters in either the sequence or the enzyme recognition site.
As in almost all sequence displays the 5'->3' direction of the top strand is from left to right. Map aligns each enzyme's name so that the name ends over the 3' end of the fragment that continues to the left. If you use the -BOTtom parameter, Map aligns the name to end over the 5'-most nucleotide of the reverse strand fragment that continues to the left.
If more than one enzyme cuts at the same position, Map sorts the set of enzymes that cut at the position alphabetically and stacks them up so that each enzyme name ends over the same position. If enzymes that cut to the left are in the way of the display, Map puts the names further up and uses a line of '|' characters to connect the name to the cut position.
When you search for potential restriction sites with either the -MISmatch or -SILent parameters, Map differentiates the real sites from the potential sites by capitalizing the enzyme's name at the real sites.
The program presents you with an enzyme selection prompt that lets you enter enzymes individually or collectively. To get help with selecting enzymes, type a ? at the enzyme prompt. Here is what you see:
Select enzymes: Type "*" to select all enzymes. Type "**" to select all enzymes including isoschizomers. Type individual names like "AluI" to select specific enzymes. Type "?" to see this message and all available enzymes. Type "??" to see the available enzymes AND their recognition sites. Type "?A*" to see what enzymes start with "A." Type "A*" to select all enzymes starting with "A." Type parts of names like "Al*" to select all enzymes starting with "AL." Type "~A*" to unselect all selected enzymes starting with "A." Type "/*" to see what enzymes you have selected so far. Type "#" to select no enzymes at all. Press <Return> after each selection. Press <Return> and nothing else to end your selections. Spaces are allowed; upper and lower case are equivalent.
We maintain our enzyme files with a semicolon (;) character in front of all but one member of a family of isoschizomers. (Isoschizomers are restriction endonucleases with the same recognition site.) The isoschizomers beginning with a semicolon are normally not displayed by our mapping programs unless you specifically select them by name or type "**" instead of "*" at the enzyme prompt.
There is more information on enzyme files in Appendix VII.
A command-line expression like -ENZymes=AluI,EcoRII would choose AluI and EcoRII and suppress interactive enzyme selection.
The translation menu allows several responses. You can name the frames of interest individually with a response like abcf. You can use t or s to mean the three forward or all six possible translation frames. You can make all of the characters in your response uppercase to get three-letter instead of one-letter amino acid symbols in the translation. You can add o to your response to get translation only between potential start codons and stop codons (o by itself gives open reading frame translation of all six translation frames).
You can use an expression like -MENu=abcf to choose translation frames a, b, c, and f from the command line.
You can select translation for open reading frames only. All of the frames are treated as open at the 5' end of each strand; these pseudo-open reading frames run to the first stop codon in that frame (see the discussion of translation tables in Appendix VII). Thereafter, reading is turned on at each potential start codon and runs to the next stop codon. You can suppress the display of short open reading frames with an expression like -OPEn=20 on the command line which would restrict the display to frames coding for at least 20 amino acids.
Open reading frames are determined from the beginning and ending of the sequence in the file--not from just the range you have chosen. The potential start codons and stop codons are defined in the data file translate.txt.
If you want to analyze the restriction sites in another program you can display all the cut positions in a table. Use -TABle on the command line to get output like this:
(Linear) MAP of: gamma.seq check: 6474 from: 2161 to: 2600 Human fetal beta globins G and A gamma from Shen, Slightom and Smithies, Cell 26; 191-203. Analyzed by Smithies et al. Cell 26; 345-353. With 216 enzymes: * Enzyme + - September 25, 1996 12:24 .. BfaI 2165 2167 BspGI 2170 2170 BsaHI 2174 2176 //////////////////////
Normally, the table is sorted
by position first and then
alphabetically by enzyme name.
You can sort
the table by enzyme name
first and then by position
with -SORtbyenzyme.
To assist scientists doing site-directed mutagenesis, this program searches for places in your sequence where a restriction enzyme recognition site occurs with one or more mismatches. Use the command-line parameter -MISmatch=1 to identify positions where recognition could occur with one or fewer mismatches.
Use the command-line parameter -SILent to find the places in your sequence where a restriction site could be introduced without changing the translation. Read more about using -SILent under the OPTIONAL PARAMETERS topic below.
By changing the enzyme data file (see the LOCAL DATA FILES topic below), you can make this program search for any pattern. See Appendix VII for notes on enzyme data files.
FindPatterns, Map, MapSort, MapPlot, and Motifs all let you search with ambiguous expressions that match many different sequences. The expressions can include any legal GCG sequence character (see Appendix III). The expressions can also include several non-sequence characters, which are used to specify OR matching, NOT matching, begin and end constraints, and repeat counts. For instance, the expression TAATA(N){20,30}ATG means TAATA, followed by 20 to 30 of any base, followed by ATG. Following is an explanation of the syntax for pattern specification.
Parentheses () enclose one or more symbols that can be repeated some number of times. Braces {} enclose numbers that tell how many times the symbols within the preceding parentheses must be found.
Sometimes, you can leave out part of an expression. If braces appear without preceding parentheses, the numbers in the braces define the number of repeats for the immediately preceding symbol. One or both of the numbers within the braces may be missing. For instance, both the pattern GATG{2,}A and the pattern GATG{2}A mean GAT, followed by G repeated from 2 to 350,000 times, followed by A; the pattern GATG{}A means GAT, followed by G repeated from 0 to 350,000 times, followed by A; the pattern GAT(TG){,2}A means GAT, followed by TG repeated from 0 to 2 times, followed by A; the pattern GAT(TG){2,2}A means GAT, followed by TG repeated exactly 2 times, followed by A. (If the pattern in the parentheses is an OR expression (see below), it cannot be repeated more than 2,000 times.)
If you are searching nucleic acids, the ambiguity symbols defined in Appendix III let you define any combination of G, A, T, or C. If you are searching proteins, you can specify any of several symbol choices by enclosing the different choices in parentheses and separating the choices with commas. For instance, RGF(Q,A)S means RGF followed by either Q or A followed by S. The length of choices need not be the same, and there can be up to 31 different choices within each set of parentheses. The pattern GAT(TG,T,G){1,4}A means GAT followed by any combination of TG, T, or G from 1 to 4 times followed by A. The sequence GATTGGA matches this pattern. There can be several parentheses in a pattern, but parentheses cannot be nested.
The pattern GC~CAT means GC, followed by any symbol except C, followed by AT. The pattern GC~(A,T)CC means GC, followed by any symbol except A or T, followed by CC.
The pattern <GACCAT can only be found if it occurs at the beginning of the sequence range being searched. Likewise, the pattern GACCAT> would only be found if it occurs at the end of the sequence range.
Slightom et al. (Biotechniques, 17; 536-544 (1994)) have shown that some of the 262,144 potential 9-mers prime selectively enough to reduce the custom-primer costs that are usually associated with primer-walking sequencing strategies.
The 9-mers identified by Slightom
et al. are available as a
kit called OligoArray 1(TM) from
Genosys Biotechnologies, Inc., 1442 Lake
Front Circle, Suite 185, The
Woodlands, Texas, USA 77380,
telephone (800) 234-5362. This
program can find where the
9-mers in this kit appear
in your sequence.
To search for these 9-mers
in your sequence, copy the
file genosys.dat into your working
directory with
Fetch and then use the
command-line parameter -DATa=genosys.dat
All parameters for this program may be put on the command line. Use the parameter -CHEck to see the summary below and to have a chance to add things to the command line before the program executes. In the summary below, the capitalized letters in the parameter names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.
Minimal Syntax: % map [-INfile=]gamma.seq -Default
Prompted Parameters:
-BEGin=2161 -END=2600 range of sequence in which to look for sites
-ENZymes=*[,...] chooses the enzymes used in the search
-MENu=s translation frames s=six, t=three, o=open
[-OUTfile=]gamma.map output file name
Local Data Files:
-DATa=enzyme.dat restriction enzyme names and recognition sites
-DATa=proenzyme.dat peptidases and peptide cleavage reagents
-TRANSlate=translate.txt the genetic code
Optional Parameters:
-WIDth=100 sets display width to something other than 60 bp-line
-PAGe[=62] adds form-feeds to keep clusters on a single page
-OPEn[=20] translates only in open reading frames [minimum ORF length]
-ONCe shows only enzymes that cut once
-MINCuts=2 shows only enzymes that cut at least 2 times
-MAXCuts=2 shows only enzymes that cut no more than 2 times
-EXCLude=n1,n2 doesn't show enzymes that cut between bases n1 and n2
-ALL finds "overlapping-set" matches
-PERFect finds only perfect symbol matches between site and sequence
-CIRcular treats the sequence as circular
-LINear treats the sequence as linear (default)
-APPend appends enzyme data file to your output
-THReeletter uses three-letter amino acid codes to show translation
-SILent finds translationally silent potential restriction sites
-MISmatch=1 finds restriction sites with one or fewer mismatches
-NOSEQline suppresses the sequence display
-NOSCALeline suppresses the scale line
-NOCOMPline suppresses the complement sequence display
-NOCUTline suppresses line of '|' characters showing cut points
-MINSitelen=6 selects enzymes with 6 (or more) bases in recognition site
-OVErhang=0 selects only blunt-end cutters ("5" for 5', "3" for 3')
-VERtical displays enzyme names vertically over cut points
-BOTtom shows both forward and reverse strand cut points
-CUTters[=fn] writes enzyme data file with enzymes that did cut
-NONCUTters[=fn] writes enzyme data file with enzymes that did not cut
-EXCUTters[=fn] writes enzyme data file with enzymes that were excluded
-TABle shows the map as a list of cut positions, sorted by position
-SORtbyenzyme sorts table output first by enzyme, then by cut position
-NOMONitor suppresses the screen monitor
-NOSUMmary suppresses the screen summary
We are grateful to Frank Manion for suggestions and for code used in the revision of Map for version 9.0. The vertical enzyme output format of Map was designed by John Schroeder and Frederick Blattner (NAR 10; 69-84 (1982), Figure 1). Map was written for the first release of the Wisconsin Package(TM) by Paul Haeberli and John Devereux.
The files described below supply auxiliary data to this program. The program automatically reads them from a public data directory unless you either 1) have a data file with exactly the same name in your current working directory; or 2) name a file on the command line with an expression like -DATa1=myfile.dat. For more information see Chapter 4, Using Data Files in the User's Guide.
This program reads the public or local version of enzyme.dat to get the enzyme names, recognition sites, cut positions, and overhangs. You can use mapping programs to search for any sequence pattern by adding the pattern to the enzyme data file. If you use the command-line parameter -APPend, this program appends the enzyme data file to the output file. (See Appendix VII for more information about enzyme data files.)
If Map finds Type: P on the dividing line in the sequence file, it reads proteolytic cleavage data in the local data file proenzyme.dat.
The translation of codons to amino acids, the identification of potential start codons and stop codons, and the mappings of one-letter to three-letter amino acid codes are all defined in a translation table in the file translate.txt. If the standard genetic code does not apply to your sequence, you can provide a modified version of this file in your working directory or name an alternative file on the command line with an expression like -TRANSlate=mycode.txt. Translation tables are discussed in more detail in Appendix VII. If you use the command line parameters -APPend, this program appends the enzyme data file to the output file. If you have provided your own translation scheme that file is also appended.
The parameters listed below can be set from the command line. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.
restricts the display of translations to open reading frames (ORFs). If you supply a number like 20 with this parameter, the ORF would only be displayed if it coded for at least 20 amino acids.
tells Map to treat your sequence as circular. If a possible recognition site starts at the end and continues into the beginning of the sequence, the site is marked at the point where a circular molecule would be cut. For instance if your sequence ends in GAA and starts with TTC, Map shows an EcoRI cut two bases before the end of the sequence. The sequence is only circularized at the ends found in the file, so if you want a subrange to be treated as circular you have to create a file in which the subrange is the entire sequence (see the Assemble program).
is the opposite of -CIRcular. If you have defined a command that runs Map with -CIRcular as the default, use the -LINear parameter to make Map treat your sequence as linear.
Printed output from this program may cross from one page to another in an annoying way. Use this parameter to add form feeds to the output file in order to try to keep clusters of related information together. You can set the number of lines per page by supplying a number after -PAGe.
allows you to choose the number of bases shown on each line of output. The standard is 60, which can be shown on a terminal screen nicely, but 100 sequence symbols per line is very convenient for estimating the size of fragments between cuts.
sets the translation to show three-letter amino acid codes instead of the one-letter codes. Normally you can set the translation to show three-letter amino acid codes by capitalizing your response to the protein translation program prompt. However, when you choose protein translation from the command line, you must add -THReeletter to get three-letter amino acid codes.
causes the program to recognize sites that are like the recognition site but with one or fewer mismatches. If you allow too many mismatches, you may get ridiculous results. The output from most mapping programs distinguishes between sites with no mismatches and sites with mismatches.
shows the places where restriction sites can be introduced (by site-directed mutagenesis) without changing the peptide translation of the sequence. The -SILent parameter assumes that the range you have chosen defines a coding region and reading frame precisely. Sites may be found that have any number of bases changed as long as the changes do not alter the translation. The reading frame is implied by the beginning coordinate you specify. The output from most mapping programs distinguishes between real sites and sites with one or more mismatches. The data file translate.txt defines the genetic code.
sets the program to look for a perfect alphabetic match between the site and the sequence. Ambiguity codes are normally translated so that the site RXY would find sequences like ACT or GAC. With this parameter, the ambiguity codes are not translated so the site RXY would only match the sequence RXY. This parameter is not the same as -MISmatch=0!
makes an overlap-set map instead of the usual subset map. If your sequence is very ambiguous (for instance, as a back-translated sequence would be) and you want to see where restriction sites could be, then an overlap-set map is for you. Overlap-set and subset pattern recognition is discussed in more detail in the Program Manual entry for Window.
appends the enzyme data file to your output file. If you provided your own translation scheme, that file is also appended.
writes out a new enzyme
data file containing those selected
enzymes that did cut your
sequence
and were not excluded with
any of the -MINCuts, -ONCe,
-MAXCuts, and -EXClude
parameters. If you do
not add a file name
to the -CUTters parameter the
output file will have
the name of your sequence
followed by the file name
extension .cutters
writes out a new enzyme
data file containing the selected
enzymes that did NOT cut
your
sequence. If you do
not add a file name
to this parameter the output
file will have the name
of
your sequence followed by the
file name extension .noncutters
writes out a new enzyme data file containing those enzymes that did cut your sequence but were excluded with any of the -EXClude, -MINCuts, -ONCe, and -MAXCuts parameters. If you do not add a file name to this parameter the output file will have the name of your sequence followed by the file name extension .excutters
The parameters -MINSitelen and -OVErhang restrict the domain of enzymes selected.
selects only enzymes with six or more bases in the recognition site. You can display the cuts from any enzyme in the enzyme data file that you take the trouble to name individually, but when you use * (meaning all), the program uses all of the other enzymes whose recognition sites have six or more non-N, non-X bases. -MINSitelen=6 replaces the -SIXbase parameter from earlier versions of the Wisconsin Package.
selects only enzymes that leave blunt ends. Use a 5 with this parameter to search only with enzymes that leave 5' overhangs and a 3 to search only with enzymes that leave a 3' overhang. You can use multiple values, separated by commas. For instance, -OVErhang=5,3 searches with all enzymes that leave either 5' or 3' overhangs. You can display the cuts from any enzyme in the enzyme data file that you take the trouble to name individually, but when you use * (meaning all), the program uses all of the enzymes whose overhangs conform to your choice with this parameter.
The -MINCuts, -MAXCuts, -ONCe, and -EXCLude parameters suppress the display of selected enzymes. The list of excluded enzymes in the program output includes both selected enzymes that cut within excluded ranges and selected enzymes that did not cut the right number of times.
excludes enzymes that do not cut at least two times.
excludes enzymes that cut more than two times.
excludes, from the set of enzymes displayed, those enzymes that cut your sequence more than once (equivalent to setting both mincuts and maxcuts to one).
excludes enzymes that cut anywhere within one or more ranges of the sequence. If an enzyme is found within an excluded range, then the enzyme is not displayed. The list of excluded enzymes includes enzymes that cut within excluded ranges. The ranges are defined with sets of two numbers. The numbers are separated by commas. Spaces between numbers are not allowed. The numbers must be integers that fall within the sequence beginning and ending points you have chosen. The range may be circular if circular mapping is being done. Exclusion is not done if there are any non-numeric characters in the numbers or numbers out of range or if there is an odd number of integers following the parameter.
Usually, translation is based on the translation table in a default or local data file called translate.txt. This parameter allows you to use a translation table in a different file. (See Appendix VII for information about translation tables.)
shows where each enzyme cuts the reverse strand as well as the forward strand. The cut point on the bottom strand is the 5' end of the fragment which continues to the left.
HgaI
SimI
NlaIII|
BsaJI ||
DsaI ||
NcoI ||
StyI ||
BsaHI | || RleAI
BspGI | | || MnlI BseRI |
BfaI | | | || MnlI | CviJI | | CviJI
| | | | || | | | | | |
GCTCCTAGTCCAGACGCCATGGGTCATTTCACAGAGGAGGACAAGGCTACTATCACAAGC
2161 ---------+---------+---------+---------+---------+---------+ 2220
CGAGGATCAGGTCTGCGGTACCCAGTAAAGTGTCTCCTCCTGTTCCGATGATAGTGTTCG
| | || | ||| | || | |
BfaI | BsaHI|StyI ||| | CviJI| | CviJI
BspGI NlaIII |SimI|| | BseRI |
NcoI MnlI| | RleAI
DsaI HgaI |
BsaJI MnlI
shows enzyme names vertically over (or under) the position where they cut. When a collision at a cut point requires more than one enzyme to be displayed at that point, Map uses the next unoccupied column to the right. A '/' below the enzyme's name indicates that the name of the enzyme has been displaced. When the number of finds is very great, the resolution of this kind of display is inadequate. If the display seems too full, either restrict the number of enzymes chosen or use the default horizontal enzyme display.
N
B B B l C B R C
B s s sDNSaH M M v s l v
f p a asctIg n n i e e i
a G H JaoyIa l l J R A J
I I I IIIIII I I I I I I
| | | |///|| | | | | | |
GCTCCTAGTCCAGACGCCATGGGTCATTTCACAGAGGAGGACAAGGCTACTATCACAAGC
2161 ---------+---------+---------+---------+---------+---------+ 2220
CGAGGATCAGGTCTGCGGTACCCAGTAAAGTGTCTCCTCCTGTTCCGATGATAGTGTTCG
The center of the Map display is a line showing the cut points with '|' characters, the top strand of the sequence, a scale, and the bottom sequence strand. These parameters let you suppress any of these lines.
suppresses the line of '|' characters between the enzyme name and the strand it cuts.
suppresses the sequence display.
suppresses the scale line between the sequence and its complement.
suppresses complement sequence display.
If you simply want a table of which enzymes cut where use this parameter. See the topic TABLE OUTPUT.
Table output is normally sorted by the position of the cut in the top strand of the sequence. Use this parameter to see the cuts sorted first by enzyme and then by position. See the topic TABLE OUTPUT.
This program normally monitors its progress on your screen. However, when you use -Default to suppress all program interaction, you also suppress the monitor. You can turn it back on with this parameter. If you are running the program in batch, the monitor will appear in the log file.
writes a summary of the program's work to the screen when you've used the -Default parameter to suppress all program interaction. A summary typically displays at the end of a program run interactively. You can suppress the summary for a program run interactively with -NOSUMmary.
You can also use this parameter to cause a summary of the program's work to be written in the log file of a program run in batch.
[ Program Manual | User's Guide | Data Files | Databases ]
Documentation Comments: doc-comments@gcg.com
Technical Support: help@gcg.com
Copyright (c) 1982, 1983, 1985, 1986, 1987, 1989, 1991, 1994, 1995, 1996 Gentics Computer Group, Inc. All rights reserved.
Licenses and Trademarks Wisconsin Package is a trademark of Genetics Computer Group, Inc. GCG and the GCG logo are registered trademarks of Genetics Computer Group, Inc.
All other product names mentioned in this documentation may be trademarks, and if so, are trademarks or registered trademarks of their respective holders and are used in this documentation for identification purposes only.